ID: 908609552_908609554

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 908609552 908609554
Species Human (GRCh38) Human (GRCh38)
Location 1:65841988-65842010 1:65842026-65842048
Sequence CCATTATCTAATTAGAAATATTA TCCCTTCGATGTAGTCATGGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 55, 4: 598} {0: 1, 1: 0, 2: 0, 3: 7, 4: 70}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!