ID: 908751275_908751278

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 908751275 908751278
Species Human (GRCh38) Human (GRCh38)
Location 1:67426134-67426156 1:67426156-67426178
Sequence CCTATCAACTGAAAATTCGCCTC CCTTCACCCTTTTCTTCAAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 60} {0: 2, 1: 1, 2: 4, 3: 16, 4: 388}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!