ID: 908892025_908892030

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 908892025 908892030
Species Human (GRCh38) Human (GRCh38)
Location 1:68859286-68859308 1:68859332-68859354
Sequence CCCAGAGTCAGTCTCTCCTCTTC TTCCTCCTGGCTCACAGTGTAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!