ID: 908914194_908914201

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 908914194 908914201
Species Human (GRCh38) Human (GRCh38)
Location 1:69107206-69107228 1:69107255-69107277
Sequence CCAGGAAATGTTTTAATGGTGGT AACTGATGGTATGAGAAGGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 34, 4: 387}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!