ID: 909153164_909153167

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 909153164 909153167
Species Human (GRCh38) Human (GRCh38)
Location 1:72034925-72034947 1:72034965-72034987
Sequence CCTGGAAGCCAGGTACATTCAAT CTTCCTTGTCACCACGTTTATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!