ID: 909181810_909181816

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 909181810 909181816
Species Human (GRCh38) Human (GRCh38)
Location 1:72433778-72433800 1:72433818-72433840
Sequence CCTATGGTTATGATTCCACTTTT TAACTGGCAGAAAGCCACATGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 18, 4: 163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!