ID: 909212662_909212667

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 909212662 909212667
Species Human (GRCh38) Human (GRCh38)
Location 1:72844217-72844239 1:72844270-72844292
Sequence CCCAAGCCCCTAGGGAGATGGCA TTTAATTCCCAACTTAACTGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!