ID: 909480289_909480293

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 909480289 909480293
Species Human (GRCh38) Human (GRCh38)
Location 1:76123024-76123046 1:76123073-76123095
Sequence CCAGATCTGCATTTTAACAAGAT GTTTAAGAAGTTTTGCTGGCTGG
Strand - +
Off-target summary {0: 2, 1: 12, 2: 41, 3: 96, 4: 412} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!