ID: 909577808_909577815

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 909577808 909577815
Species Human (GRCh38) Human (GRCh38)
Location 1:77195068-77195090 1:77195095-77195117
Sequence CCCATAGCAGGAACAACCCAGAC GAGGTGTGGTCATATTACACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 143} {0: 2, 1: 0, 2: 3, 3: 7, 4: 123}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!