ID: 909577813_909577818

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 909577813 909577818
Species Human (GRCh38) Human (GRCh38)
Location 1:77195084-77195106 1:77195103-77195125
Sequence CCCAGACTGGTGAGGTGTGGTCA GTCATATTACACAGGAAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 157} {0: 2, 1: 0, 2: 2, 3: 16, 4: 178}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!