ID: 909612981_909612991

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 909612981 909612991
Species Human (GRCh38) Human (GRCh38)
Location 1:77572703-77572725 1:77572750-77572772
Sequence CCAGGTTCACTGCAGGCCCAATT TCTCAGCCTCTTGAGTAGATGGG
Strand - +
Off-target summary No data {0: 2, 1: 455, 2: 14212, 3: 131727, 4: 229718}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!