ID: 909870357_909870362

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 909870357 909870362
Species Human (GRCh38) Human (GRCh38)
Location 1:80731095-80731117 1:80731131-80731153
Sequence CCATGTGTATTGAGAGAGGATCT AGGAAGAGCAAAGTGATTGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 11, 2: 51, 3: 114, 4: 459}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!