ID: 910192016_910192021

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 910192016 910192021
Species Human (GRCh38) Human (GRCh38)
Location 1:84604459-84604481 1:84604504-84604526
Sequence CCGACAGGGGGATTTCGTGATCC CCTAATGATAGCACTTCCTGGGG
Strand - +
Off-target summary No data {0: 2, 1: 1, 2: 3, 3: 13, 4: 106}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!