ID: 910277522_910277531

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 910277522 910277531
Species Human (GRCh38) Human (GRCh38)
Location 1:85464969-85464991 1:85464998-85465020
Sequence CCGAGCGACTCGGGTAGCGCCCG GGCGTGGGTGGCCCGGCCGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 18} {0: 1, 1: 0, 2: 1, 3: 37, 4: 432}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!