ID: 910320332_910320335

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 910320332 910320335
Species Human (GRCh38) Human (GRCh38)
Location 1:85936591-85936613 1:85936607-85936629
Sequence CCAAGATAGAGGAATTAACACTC AACACTCTGGCAAGGACCCCAGG
Strand - +
Off-target summary No data {0: 2, 1: 2, 2: 11, 3: 36, 4: 171}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!