ID: 910320332_910320341

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 910320332 910320341
Species Human (GRCh38) Human (GRCh38)
Location 1:85936591-85936613 1:85936632-85936654
Sequence CCAAGATAGAGGAATTAACACTC GTTGCACAAGCTCCTACAGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 8, 4: 95}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!