ID: 910501768_910501773

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 910501768 910501773
Species Human (GRCh38) Human (GRCh38)
Location 1:87900590-87900612 1:87900606-87900628
Sequence CCCATCTCTTTCTCCTTCTTCAT TCTTCATGCCTCATTTGGGCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!