ID: 910556611_910556621

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 910556611 910556621
Species Human (GRCh38) Human (GRCh38)
Location 1:88541546-88541568 1:88541599-88541621
Sequence CCTTGAGCCATTCATTAGGGATC TCTGCTCCACCTCCATCCTTAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!