ID: 910676493_910676498

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 910676493 910676498
Species Human (GRCh38) Human (GRCh38)
Location 1:89821355-89821377 1:89821375-89821397
Sequence CCGCGCCGAGCCGGAGCGCGCAA CAACCCTGGCGCAGGCGCCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 34} {0: 1, 1: 0, 2: 1, 3: 8, 4: 159}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!