|
Left Crispr |
Right Crispr |
Crispr ID |
910792941 |
910792948 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
1:91069876-91069898
|
1:91069892-91069914
|
Sequence |
CCTCCCACCTTCAGCCTTTCAAG |
TTTCAAGTAGCTGGGACTACAGG |
Strand |
- |
+ |
Off-target summary |
No data |
{0: 122, 1: 3885, 2: 56532, 3: 177491, 4: 237833} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|