ID: 910891739_910891746

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 910891739 910891746
Species Human (GRCh38) Human (GRCh38)
Location 1:92026449-92026471 1:92026465-92026487
Sequence CCAGGCAGAGACGCTCCTCACTT CTCACTTCCCAGATGGGGTGGGG
Strand - +
Off-target summary {0: 3009, 1: 4104, 2: 7826, 3: 9138, 4: 3047} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!