ID: 911012604_911012606

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 911012604 911012606
Species Human (GRCh38) Human (GRCh38)
Location 1:93297082-93297104 1:93297106-93297128
Sequence CCAAAATGCACAGATTCTCTCTC GCGCTATATAACCTACTGCTGGG
Strand - +
Off-target summary {0: 12, 1: 49, 2: 113, 3: 210, 4: 629} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!