ID: 911061498_911061507

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 911061498 911061507
Species Human (GRCh38) Human (GRCh38)
Location 1:93751807-93751829 1:93751843-93751865
Sequence CCAACACAAGGGCGTGTGGCTGG GCAAGGCCTCCCCAGCCTGGCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 34, 3: 335, 4: 4461}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!