ID: 911184124_911184130

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 911184124 911184130
Species Human (GRCh38) Human (GRCh38)
Location 1:94886464-94886486 1:94886514-94886536
Sequence CCTGCTGGTATGCTCATGTCTGT CCTCCTACCCTGCTGGAGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 139} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!