ID: 911239521_911239528

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 911239521 911239528
Species Human (GRCh38) Human (GRCh38)
Location 1:95449695-95449717 1:95449742-95449764
Sequence CCACAAGCACTGTGCTCTCTTTC CAAGCCACATGACTGCTGCTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!