ID: 911503524_911503532

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 911503524 911503532
Species Human (GRCh38) Human (GRCh38)
Location 1:98719175-98719197 1:98719222-98719244
Sequence CCTAGCTCATAGTGCTAAATGTG TATTGCCTGGCCCATAGGAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 111} {0: 1, 1: 0, 2: 2, 3: 26, 4: 183}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!