ID: 912185263_912185267

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 912185263 912185267
Species Human (GRCh38) Human (GRCh38)
Location 1:107267653-107267675 1:107267697-107267719
Sequence CCACCATACTCTTGCCCTCAGGT AACATAGAGCAATTAGCCCCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 7, 4: 82}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!