ID: 912401636_912401646

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 912401636 912401646
Species Human (GRCh38) Human (GRCh38)
Location 1:109398038-109398060 1:109398065-109398087
Sequence CCTCTTCCCCGGCCCACTCCTCA CTCGCGTCGCCTCCGGCTTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 63, 4: 759} {0: 1, 1: 0, 2: 0, 3: 4, 4: 42}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!