ID: 912401638_912401646

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 912401638 912401646
Species Human (GRCh38) Human (GRCh38)
Location 1:109398044-109398066 1:109398065-109398087
Sequence CCCCGGCCCACTCCTCATTGGCT CTCGCGTCGCCTCCGGCTTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 172} {0: 1, 1: 0, 2: 0, 3: 4, 4: 42}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!