ID: 912401641_912401652

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 912401641 912401652
Species Human (GRCh38) Human (GRCh38)
Location 1:109398050-109398072 1:109398079-109398101
Sequence CCCACTCCTCATTGGCTCGCGTC GGCTTCGGGGGTCCTGGATTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 54} {0: 1, 1: 0, 2: 1, 3: 14, 4: 172}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!