ID: 912497583_912497597

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 912497583 912497597
Species Human (GRCh38) Human (GRCh38)
Location 1:110101515-110101537 1:110101564-110101586
Sequence CCCCGGAGCCAGGCAGGATGCAG CACCCTCGCTCTGCCCTGCCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 46, 4: 377} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!