ID: 912497599_912497612

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 912497599 912497612
Species Human (GRCh38) Human (GRCh38)
Location 1:110101566-110101588 1:110101613-110101635
Sequence CCCTCGCTCTGCCCTGCCAGGGA GAGTTCAGGATGGGGAGAGCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!