ID: 912525080_912525082

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 912525080 912525082
Species Human (GRCh38) Human (GRCh38)
Location 1:110276663-110276685 1:110276686-110276708
Sequence CCATCAATCTCTTAGGAGGCTCA TTGGCATGTGTTAGTCCTATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 124} {0: 1, 1: 0, 2: 0, 3: 4, 4: 103}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!