ID: 912567664_912567672

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 912567664 912567672
Species Human (GRCh38) Human (GRCh38)
Location 1:110599863-110599885 1:110599901-110599923
Sequence CCTATATTAGGCTACCAGCTGTC CCCTGCACCCAGGTTTCTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 60} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!