ID: 912682404_912682413

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 912682404 912682413
Species Human (GRCh38) Human (GRCh38)
Location 1:111737916-111737938 1:111737946-111737968
Sequence CCCTACCCCCAGAGCTGGCCCCT TGCCAAGTTCCTTCCCAAGCAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 3, 3: 88, 4: 3460} {0: 1, 1: 0, 2: 1, 3: 22, 4: 155}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!