ID: 912698880_912698889

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 912698880 912698889
Species Human (GRCh38) Human (GRCh38)
Location 1:111861531-111861553 1:111861556-111861578
Sequence CCAGGCCCACTGCAGGACCTTGT CTGTGTTTACGGAGGGAAGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 281} {0: 1, 1: 0, 2: 1, 3: 20, 4: 133}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!