ID: 912698881_912698892

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 912698881 912698892
Species Human (GRCh38) Human (GRCh38)
Location 1:111861536-111861558 1:111861566-111861588
Sequence CCCACTGCAGGACCTTGTTCCTG GGAGGGAAGCGGGTGGCAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 248} {0: 1, 1: 1, 2: 9, 3: 194, 4: 1666}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!