ID: 912698882_912698894

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 912698882 912698894
Species Human (GRCh38) Human (GRCh38)
Location 1:111861537-111861559 1:111861568-111861590
Sequence CCACTGCAGGACCTTGTTCCTGT AGGGAAGCGGGTGGCAGGAGGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 12, 3: 91, 4: 959}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!