ID: 912873242_912873250

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 912873242 912873250
Species Human (GRCh38) Human (GRCh38)
Location 1:113328864-113328886 1:113328916-113328938
Sequence CCACAATTACTGCATTCTCCCTC CCATTTGGCCATCCATTGCCAGG
Strand - +
Off-target summary {0: 1, 1: 7, 2: 43, 3: 113, 4: 370} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!