ID: 912896106_912896112

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 912896106 912896112
Species Human (GRCh38) Human (GRCh38)
Location 1:113591655-113591677 1:113591706-113591728
Sequence CCACAATTATACAAAGCAGGTAC CAACTTTAAGGGATTTGTTAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 15, 4: 196}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!