ID: 913187767_913187773

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 913187767 913187773
Species Human (GRCh38) Human (GRCh38)
Location 1:116385558-116385580 1:116385595-116385617
Sequence CCACAGTTCCTGGTTCATAACTC ACAGTCGTTTGTTATAATGTTGG
Strand - +
Off-target summary {0: 2, 1: 34, 2: 79, 3: 154, 4: 397} {0: 1, 1: 34, 2: 88, 3: 125, 4: 171}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!