|
Left Crispr |
Right Crispr |
| Crispr ID |
913187767 |
913187774 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:116385558-116385580
|
1:116385596-116385618
|
| Sequence |
CCACAGTTCCTGGTTCATAACTC |
CAGTCGTTTGTTATAATGTTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 34, 2: 79, 3: 154, 4: 397} |
{0: 1, 1: 36, 2: 92, 3: 102, 4: 195} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|