ID: 913249540_913249545

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 913249540 913249545
Species Human (GRCh38) Human (GRCh38)
Location 1:116901134-116901156 1:116901152-116901174
Sequence CCACACATGTGCCAAACGCTGCA CTGCAGCACAAGGATGGGCTAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 21, 4: 262}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!