ID: 913470380_913470385

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 913470380 913470385
Species Human (GRCh38) Human (GRCh38)
Location 1:119180379-119180401 1:119180399-119180421
Sequence CCAACCAGACACATTAGGACCCC CCCTCGGATAGTGACAGATCTGG
Strand - +
Off-target summary No data {0: 37, 1: 69, 2: 32, 3: 7, 4: 72}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!