ID: 913470380_913470387

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 913470380 913470387
Species Human (GRCh38) Human (GRCh38)
Location 1:119180379-119180401 1:119180402-119180424
Sequence CCAACCAGACACATTAGGACCCC TCGGATAGTGACAGATCTGGAGG
Strand - +
Off-target summary No data {0: 41, 1: 67, 2: 18, 3: 16, 4: 89}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!