ID: 913597742_913597743

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 913597742 913597743
Species Human (GRCh38) Human (GRCh38)
Location 1:120394454-120394476 1:120394474-120394496
Sequence CCTTAAAATATTGCTTGGGTTGC TGCCTTAGATCTAGTCATGTTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 1, 3: 8, 4: 131} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!