ID: 913957640_913957644 |
View in Genome Browser |
Spacer: -10 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 913957640 | 913957644 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 1:143319366-143319388 | 1:143319379-143319401 |
| Sequence | CCTCCAAGTCCATCTCTGGCCCT | CTCTGGCCCTGCCTTGGCCCTGG |
| Strand | - | + |
| Off-target summary | No data | {0: 32, 1: 6, 2: 64, 3: 186, 4: 1091} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||