ID: 913975125_913975130

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 913975125 913975130
Species Human (GRCh38) Human (GRCh38)
Location 1:143449855-143449877 1:143449889-143449911
Sequence CCAGGGAGGAAATCCTGCGGATC GATGCTGTAGATGCGCGTGTAGG
Strand - +
Off-target summary No data {0: 1, 1: 4, 2: 1, 3: 5, 4: 46}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!