ID: 913975128_913975131

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 913975128 913975131
Species Human (GRCh38) Human (GRCh38)
Location 1:143449868-143449890 1:143449904-143449926
Sequence CCTGCGGATCTGCACCTGGGCGA CGTGTAGGTCACGATCATGATGG
Strand - +
Off-target summary No data {0: 6, 1: 0, 2: 0, 3: 2, 4: 24}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!