ID: 913975129_913975132

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 913975129 913975132
Species Human (GRCh38) Human (GRCh38)
Location 1:143449882-143449904 1:143449910-143449932
Sequence CCTGGGCGATGCTGTAGATGCGC GGTCACGATCATGATGGCCATGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 1, 3: 0, 4: 47} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!